Editer l'article Suivre ce blog Administration + Créer mon blog
28 décembre 2011 3 28 /12 /décembre /2011 22:30

Le mot est lancé : tests génétiques . Déjà , on sait que les discussions seront âpres. C'est une tribune postée en octobre dernier et que je viens de trouver en faisant un tour d'horizon "google" des mots clé : "généalogie génétique" ( une façon de prendre le poul de ce qui s'écrit fin 2011) qui m'incite à faire cet article en vue d'une discussion plus large. La tribune postée ici :


a le mérite d'être bien pourvue en liens et de cibler le côté légal. Je vais donc suivre cette piste en prenant  le taureau par les cornes et en faisant le point des techniques et des enjeux.

Le législateur en France fait mine de considérer le cas des tests génétiques comme bien réglé et la modification de la loi sur la bioéthique sans évolution des textes sur les tests génétiques a été une façon  de revalider un texte obsolète sans en parler. Que dit la loi française ? Voici quelques liens utiles :



Je retiens 2 points de la loi : premièrement le texte de 2004 met en avant les "empreintes génétiques" , ensuite la loi bioéthique de 2011 fait mine d'avoir dépoussiéré en labelisant 2011 un texte qui n'est toujours pas plus précis et qui continue à cibler les dites empreintes sans mieux les définir.

 Il faut dès lors que je me lance dans une tentative d'explication de texte. En 2004, on pouvait comprendre sans trop d'ambiguités que le texte faisait référence à une avancée récente (en 2004) de nos connaissances du génôme. On a trouvé chez tous les organismes supérieurs, dont l'homme, des sites (nombreux) où l'ADN présente une  organisation répétée en tandem du type AGTCAGTCAGTCAGTCAGTC qui se lit (ici) [AGTC]5x. Il s'agit d'un exemple. Ces zones sont l'objet de mutations beaucoup plus fréquentes par perte ou gain d'un motif répété. Donc, il ne s'agit pas d'une mutation ponctuelle de l'ADN mais d'un "begaiement" de notre génétique. Il n'y a pas de fonction connue et il n'y a aucun gène touché : c'est tout à fait neutre vis à vis de nos fonctions vitales , dans notre compréhension actuelle. Ce sont ces mutations, mal comprises mais bien décrites, qui sont utilisées et nommées "empreintes génétiques". Présentes sur TOUS nos chromosomes elles permettent de faire des sortes de codes barres où chacun est repérable et où les filiations peuvent être prouvées (ou non). En 2004 c'était ça et seulement ça qui était visé. Cette méthode d'investigation est comme on le sait très utilisée par la police car on peut la pratiquer sur des traces infimes en amplifiant, préalablement à l'analyse, l'ADN des échantillons. En une dizaine d'années l'ADN est devnu incontournable ; on pouvait comprendre un certain émoi il y a encore 5 ou 6 ans et qu'il ait été relativement facile d'effrayer le badaud.

Où en sommes nous en 2011 ? Premier point, les évolutions dont je vais parler se font sans les compagnies et labos français qui sont en quelque sorte sur la touche . Il se trouve qu'en parallèle du développement des tests basés sur les "empreintes génétiques" on n'a pas vu venir les progrès du séquençage ADN . Aujourd'hui le projet "1000 genomes" a passé le cap des 2000 genômes (humains) entièrement séquencés :

voir : http://www.1000genomes.org/

 Je ne veux pas ergoter mais il me paraît impossible de lire sous "empreintes génétiques" la séquence complète d'un individu ! Or, des compagnies proposent déjà de tels séquençages car la technique avance à grand pas (pas en France encore une fois) et les tarifs chûtent. je renonce à mettre en ligne ici un lien mais il n'y a que le coût encore prohibitif pour un quidam moyen qui fasse barrage. L'automatisation a été un facteur déterminant et aujourd'hui il est possible à ceux qui ont les derniers robots de séquencer 1000 génomes par mois. je donne ces informations uniquement pour montrer une évolution rapide en marche. C'est dans ce contexte qu'on veut nous présenter un dépoussiérage sur l'air de "tout va très bien madame la marquise" ; d'où ce billet d'humeur. En gros, on va vers un séquençage complet pour une somme d'environ 5000 euros et une qualité acceptable. Ce n'est pas donné mais ça devient accessible à pas mal de revenus quand même ; non ?

 Sans aller jusqu'au séquençage total il est possible aujourd'hui pour 300 euros d'obtenir la séquence complète de son ADN mitochondrial. Je ne vois pas comment une personne qui se soit fait faire un tel séquençage total pourraît tomber sous le coup de la loi précitée sauf à torturer les mots et à leur faire dire n'importe quoi. L'un des points de cet article est de combattre l'idée reçue que toutes les analyses ADN sont interdites en France aux particuliers ; et le faire savoir.

 Une autre technique est née en 2008, plus exactement, elle est devenue accessible aux particuliers : l'analyse par puce ADN. le principe de la puce ADN est bien plus ancien mais l'application à l'analyse des gènes  par une compagnie dans un but de prédiction de risques est récente. le succès a été au rendez-vous au plan international, sous les quolibets des mêmes qui avaient empêché les tests génétiques en france. On cible des polymorphismes connus et ce qui fait débat c'est la qualité prédictive. Sans surprendre, je pense qu'on peut dire que si la qualité en 2008 était encore faible la situation change. Cette méthode d'analyse est clairement entrée dans la pratique grace à son coût durablement plus faible que le séquençage total. La puce proposée aujourd'hui teste 1 million de polymorphismes (pour environ 150 euros) et bientôt ce seront 2 millions de polymorphismes et une meilleure compréhension et analyse des résultats. Au passage, ces tests analysent le chromosome Y et l'ADN mitochondrial pour une analyse, non pas des empreintes génétiques mais des mutations ponctuelles qui ont jalonné les dernières 100 ou 200 générations et qui permettent aux scientifiques de définir des "haplogroupes" du chromosome Y (quand on suit les mutations apparues sur le chromosome Y) ainsi que les haplogroupes mitochondriaux. Ces tests par puce ADN ont permis, lorsqu'une banque de données suffisament importante existe d'identifier des parentés lointaines (cas de juifs, ou d'arméniens, par exemple).

 Peut être qu'en 2004 on pouvait douter et penser que le point de vue français aurait la vertu de modérer les tests et qu'on empêchait ainsi des débordements de la technique. J'accuse les promoteurs de ces dispositions d'avoir freiné tout développement sur l'ADN au niveau des laboratoires d'analyse ; je parle d'une activité de services et pas de 3 ou 4 labos pointus nécessaires aux analyses juridiques et policières. On ne peut pas continuer comme ça.

Poster un message

SPIP 2.0

Partager cet article
